A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0072Publication date: 09/03
PMID: 14519257GI: 30698326 Taxonomy ID: 229993
Virus Name: SARS coronavirus TW1Product size (PCR): bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: There is no common data given in this paper.
Forward(IN-6) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 332-354Tm: 75C at salt 1000.0 mMLength:
Sequence: GGTTGGGACTATCCTAAGTGTGA
(0 other experimental conditions)
Note:
Reverse(IN-7) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 771-748Tm: 70.2C at salt 1000.0 mMLength:
Sequence: CCATCATCAGATAGAATCATCATA
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.