A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0070Publication date: 02/04
PMID: 15030703GI: 33578015 Taxonomy ID: 242743
Virus Name: SARS coronavirus FRAProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: Real-time RT-PCR
Temp (PCR cycle):48C 1800sec>95C 600sec>(95C 15sec>60C 60sec)*45
Buffer:
Polymerase: Cycler: iCycler iQ Real-Time Detection System (Bio-Rad)
Note: This reaction was performed using a Real-Time One-Step RT-PCR Master Mix (Applied Biosystems).The reaction mixtures were 25microL and contained 12.5microL of 2x Master Mix, 0.625microL of 40x MultiScribe and RNase Inhibitor, 10microM probe, 5 microL of cDNA, and 50microM of primers.
Forward(SG007001) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15371-15392Tm: 74.7C at salt 1000.0 mMLength:
Sequence: CATGTGTGGCGGCTCACTATAT
(0 other experimental conditions)
Note:
Reverse(SG007002) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15449-15422Tm: 76.2C at salt 1000.0 mMLength:
Sequence: GACACTATTAGCATAAGCAGTTGTAGCA
(0 other experimental conditions)
Note:
Forward(SG007003) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 15394-15420Tm: 79C at salt 1000.0 mMLength:
Sequence: TTAAACCAGGTGGAACATCATCCGGTG
(0 other experimental conditions)
Note:
Forward(SG007004) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 28531-28552Tm: 74.7C at salt 1000.0 mMLength:
Sequence: GGAGCCTTGAATACACCCAAAG
(1 other experimental conditions)
Note:
Reverse(SG007005) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 28597-28581Tm: 56CLength:
Sequence: GCACGGTGGCAGCATTG
(1 other experimental conditions)
Note:
Forward(SG007006) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 28554-28574Tm: 78.3C at salt 1000.0 mMLength:
Sequence: CCACATTGGCACCCGCAATCC
(0 other experimental conditions)
Note:
Forward(SG007007) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 29016-29034Tm: 67.2C at salt 1000.0 mMLength:
Sequence: CAAACATTGGCCGCAAATT
(0 other experimental conditions)
Note: Second set for Nucleocapsid region.
Reverse(SG007008) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 29083-29063Tm: 70.5C at salt 1000.0 mMLength:
Sequence: CAATGCGTGACATTCCAAAGA
(0 other experimental conditions)
Note: Second set for Nucleocapsid region.
Forward(SG007009) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 29036-29061Tm: 78.9C at salt 1000.0 mMLength:
Sequence: CACAATTTGCTCCAAGTGCCTCTGCA
(0 other experimental conditions)
Note: Second set for Nucleocapsid region.
Forward(SG007010) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 28432-28452Tm: 76.4C at salt 1000.0 mMLength:
Sequence: GAAGTACCATCTGGGGCTGAG
(0 other experimental conditions)
Note: This is the third set in the Nucleocapsid region.
Reverse(SG007011) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 28400-28383Tm: 60CLength:
Sequence: CCGAAGAGCTACCCGACG
(0 other experimental conditions)
Note: This is the third set in the Nucleocapsid region.
Forward(SG007012) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 28406-28431Tm: 78.9C at salt 1000.0 mMLength:
Sequence: CTCTTTCATTTTGCCGTCACCACCAC
(0 other experimental conditions)
Note: This is the third set in the Nucleocapsid region.
Forward(SG007013) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 29619-29642Tm: 75.3C at salt 1000.0 mMLength:
Sequence: AGCTCTCCCTAGCATTATTCACTG
(0 other experimental conditions)
Note:
Forward(SG007014) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 29595-29576Tm: 72C at salt 1000.0 mMLength:
Sequence: CACCACATTTTCATCGAGGC
(0 other experimental conditions)
Note:
Forward(SG007015) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 29597-29618Tm: 78.5C at salt 1000.0 mMLength:
Sequence: TACCCTCGATCGTACTCCGCGT
(0 other experimental conditions)
Note:
Forward(SG007016) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 26951-26973Tm: 73.2C at salt 1000.0 mMLength:
Sequence: TGTAGGCACTGATTCAGGTTTTG
(0 other experimental conditions)
Note:
Reverse(SG007017) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 27027-27005Tm: 71.5C at salt 1000.0 mMLength:
Sequence: CGGCGTGGTCTGTATTTAATTTA
(0 other experimental conditions)
Note:
Forward(SG007018) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 26974-27000Tm: 79C at salt 1000.0 mMLength:
Sequence: CTGCATACAACCGCTACCGTATTGGAA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.