A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0065Publication date: 11/03
PMID: 14718079GI: 33578015 Taxonomy ID: 242743
Virus Name: SARS coronavirus FRAProduct size (PCR): 311 bp
MgCl2: 25 mMdNTPs: mMType: Q-RT-PCR
Temp (PCR cycle):94C 180sec>(94C 30sec>60C 30sec>72C 60sec)*45>72C 7min
Buffer: 1.1x buffer (Amersham Pharmacia Biotech)
Polymerase: 5U/mL Taq polyCycler: GeneAmp PCR System 9700 (Applied Biosystem)
Note:
Forward(COR-1) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15318-15343Tm: 77.3C at salt 1000.0 mMLength:
Sequence: CACCGTTTCTACAGGTTAGCTAACGA
(6 other experimental conditions)
Note:
Reverse(COR-2) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15628-15603Tm: 72.6C at salt 1000.0 mMLength:
Sequence: AAATGTTTACGCAGGTAAGCGTAAAA
(6 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.