A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0062Publication date: 02/04
PMID: 15030701GI: 33578015 Taxonomy ID: 242743
Virus Name: SARS coronavirus FRAProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: Real-time PCR
Temp (PCR cycle):50C 120sec>95C 600sec>(95C 15sec>61C 60sec)*45
Buffer:
Polymerase: Cycler: ABI Prism 7900 HT (PE Applied Biosystems)
Note: 2 microL of cDNA was amplified using a TaqMan Universal Master Mix kit (PE Applied Biosystems).
Forward(Taq-772F) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 28891-28910Tm: 72C at salt 1000.0 mMLength:
Sequence: AAGCCTCGCCAAAAACGTAC
(0 other experimental conditions)
Note:
Reverse(Taq-1000R) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 29119-29100Tm: 72C at salt 1000.0 mMLength:
Sequence: AAGTCAGCCATGTTCCCGAA
(0 other experimental conditions)
Note:
Forward(Taq-955T) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 29074-29098Tm: 78.8C at salt 1000.0 mMLength:
Sequence: TCACGCATTGGCATGGAAGTCACAC
(0 other experimental conditions)
Note: Probe has a 6-carboxyfluorescein on the 5' end and a 6-carboxytetramethylrhodamine on the 3' end
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.