A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0057Publication date: 2004
PMID: 15080310GI: 31416305 Taxonomy ID: 228409
Virus Name: SARS coronavirus BJ03Product size (PCR): bp
MgCl2: mMdNTPs: mMType: In situ hybridization
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: In Situ Hybridization: 4 microm section of paraffin-embedded tissue was deparaffinized in xylene, dehydrated and predigested in 0.1 mg/mL of Proteinase K (Boehringer Mannheim) for 15 mins. The slide was washed with distilled water and 70% ethanol. Fluorescein isothiocyanate-conjugated antisense probe (250 ng/ml in 50% formamide, 6x standard saline citrate, an 0.25% dry milk) for various different places on the genome was placed over several tissue samples. The samples were denatured at 75C for 5min and incubated at 37C for 120min.
Reverse(REP1) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 571-540Tm: 83.3C at salt 1000.0 mMLength:
Sequence: AGTGTTATACCGCTACGACCGTACTGAATGCC
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(REP2) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 784-753Tm: 87.1C at salt 1000.0 mMLength:
Sequence: CGAGTGAGTTCACGGAGTGCACCACTGCCATG
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(REP3) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 967-931Tm: 88.6C at salt 1000.0 mMLength:
Sequence: TGCTCATGGTCACGGCAGCAGTAGACACCTCTCTTCG
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(REP4) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 1385-1347Tm: 85C at salt 1000.0 mMLength:
Sequence: GTCTTGACAGGCAGGACATGGCATTTTCACTACAGCATT
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(REP5) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 1631-1592Tm: 85C at salt 1000.0 mMLength:
Sequence: TTCACGACTCAGTATCTCAAGGAGATCCTCATTCAAGGTC
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(M1) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 26431-26397Tm: 83.1C at salt 1000.0 mMLength:
Sequence: TTAAGCTCCTCAACGGTAATAGTACCGTTGTCTGC
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(M2) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 26636-26597Tm: 85C at salt 1000.0 mMLength:
Sequence: AATCGCAATCCCGCCAGTCACCCAATTAATTCTGTAGACA
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(M3) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 26809-26773Tm: 84.1C at salt 1000.0 mMLength:
Sequence: ATGACAAGTTCACTTTCCATGAGCGGTCTGGTCACAA
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(N1) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 28376-28340Tm: 84.1C at salt 1000.0 mMLength:
Sequence: GTAGCCAATTTGGTCATCTGGACCACTATTGGTGTTG
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(N2) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 28770-28733Tm: 88.4C at salt 1000.0 mMLength:
Sequence: CAGTTTCACCACCTCCGCTAGCCATTCGAGCAGGAGAA
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Reverse(N3) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 29036-28997Tm: 82.9C at salt 1000.0 mMLength:
Sequence: TTGTGCAATTTGCGGCCAATGTTTGTAATCAGTTCCTTGT
(0 other experimental conditions)
Note: Probe has a fluorescein isothiocyanate at the 5' end.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.