A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0055Publication date: 2004
PMID: 15168202GI: 732696 Taxonomy ID: 12110
Virus Name: Foot-and-mouth disease virusProduct size (PCR): 232 bp
MgCl2: 5 mMdNTPs: mMType: PCR
Temp (PCR cycle):48C 900sec>94C 90sec>(94C 30sec>48C 30sec>72C 40sec)*35>72C 300sec
Buffer: 100mM Tris-HCl (pH 9.0)
Polymerase: 0.8U Taq poly (Roche)Cycler: GenAmpPCR 9700 (Perkin-Elmer, Applied Biosystem)
Note: The reaction was a one-tube RT-PCR. The mix also included 50mM KCl, 0.1% Triton X-100, 2.5U AMV reverse transcriptase, and 5microL RNA. Instead of 0.2mM dTTP, 0.19 mM dTTP and 0.01mM digoxigenin labelled dUTP (Boehringer) were used.
Reverse(1ur) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 1119-1096Tm: 78.7C at salt 1000.0 mMLength:
Sequence: TCGCCTTTGTCIGCTGGGGTIATG
(3 other experimental conditions)
Note: Universal Primer. The "I" located in the sequence stands for inosine.
Forward(EU2) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 880-896Tm: 54CLength:
Sequence: GGCGGIATGCCATCTGG
(1 other experimental conditions)
Note: Universal Primer. The "I" located in the sequence stands for inosine.
Forward(pf1) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 1018-1040Tm: 75C at salt 1000.0 mMLength:
Sequence: ATCGTGGTGGCAAGTGATTACGA
(0 other experimental conditions)
Note:
Forward(pf2) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 1008-1034Tm: 83.6C at salt 1000.0 mMLength:
Sequence: CGGAGACGACATCGTGGTGGCAAGTGA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.