A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0048Publication date: 12/03
PMID: 14699465GI: 3796831 Taxonomy ID: 258445
Virus Name: SARS coronavirus GD69Product size (PCR): 110 bp
MgCl2: 2 mMdNTPs: mMType: Nested RT-PCR
Temp (PCR cycle):95C 600sec>(95C 10sec>56C 5sec>72C 5sec)*35
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note: This is the nested PCR, 1microL of the first round product was diluted to 20 microL with PCR mix (LightCycler FastStart DNA Master SYBR Green I kit, Roche)
Forward(BNIinS) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18202-18221Tm: 72C at salt 1000.0 mMLength:
Sequence: GAAGCTATTCGTCACGTTCG
(7 other experimental conditions)
Note: Nested Primer
Reverse(BNIAs) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18310-18289Tm: 72.9C at salt 1000.0 mMLength:
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.