A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0047Publication date: 12/03
PMID: 14699465GI: 3796831 Taxonomy ID: 258445
Virus Name: SARS coronavirus GD69Product size (PCR): 195 bp
MgCl2: mMdNTPs: mMType: Nested RT-PCR
Temp (PCR cycle):61C 1200sec>95C 30sec>(95C 1sec>55C 10sec>72C 8sec)*25
Buffer:
Polymerase: Cycler: LightCycler (Roche)
Note: 2 microL of RNA was diluted to 20microL with PCR mix (LightCycler RNA Master SYBR Green I Kit, Roche). The reaction mix also contained 2mmol/L Mn(OAC)2
Forward(BNIoutS) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18154-18177Tm: 70.2C at salt 1000.0 mMLength:
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note:
Reverse(BNoutAs) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18343-18322Tm: 74.7C at salt 1000.0 mMLength:
Sequence: CATAACCAGTCGGTACAGCTAC
(11 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.