A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0046Publication date: 2004
PMID: 14962998GI: 510229 Taxonomy ID: 10255
Virus Name: Variola virusProduct size (PCR): 160 bp
MgCl2: 3.3 mMdNTPs: mMType: Real-time PCR
Temp (PCR cycle):94C 360sec>(94C 5sec>51C 10sec>72C 15sec)*40
Buffer: 1X Platinum Taq polymerase reaction buffer (Invitrogen)
Polymerase: 1U Platinum Taq poly (Invitrogen)Cycler: Roche LightCycler
Note: Each reaction contained 5microL of DNA and 40ng/microL Bovine serum albumin,
Forward(OPS3) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 17-40Tm: 65C at salt 1000.0 mMLength:
Sequence: TACTTTTGTTACTAATATCATTAG
(0 other experimental conditions)
Note:
Reverse(OPAs4) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 291-271Tm: 64.6C at salt 1000.0 mMLength:
Sequence: AGCAGTCAATGATTTAATTGT
(0 other experimental conditions)
Note:
Forward(OPP1) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 145-177Tm: max Tm 79.5C min Tm 78.2C at salt 1000.0mMLength:
Sequence: GCTTGGTATAAGGAGCCCAATTC(X)ATTATTCTT
(0 other experimental conditions)
Note: The (X) represents a ribose phosphate spacer nucleotide.
Forward(OPP2-640) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 179-199Tm: 72.5C at salt 1000.0 mMLength:
Sequence: TAGCTGCTAAAAGCGACGTCT
(0 other experimental conditions)
Note: The 5' end is labeled with the LCred640 dye and the 3' end is phosphorylated.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.