A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0045Publication date: 2003
PMID: 14633867GI: 30027610 Taxonomy ID: 228415
Virus Name: SARS coronavirus CUHK-W1Product size (PCR): 71 bp
MgCl2: mMdNTPs: mMType: Real-time RT-PCR
Temp (PCR cycle):95C 300sec>(94C 20sec>56C 60sec)*40
Buffer:
Polymerase: Cycler:
Note: The reactions were performed using EZ rTth RNA PCR reagent and the manufacturer's instructions. 12microL of the RNA was used in amplification.
Forward(SG004501) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15327-15349Tm: 73.2C at salt 1000.0 mMLength:
Sequence: GAGTGTGCGCAAGTATTAAGTGA
(2 other experimental conditions)
Note:
Reverse(SG004502) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15372-15351Tm: 71C at salt 1000.0 mMLength:
Sequence: TGATGTTCCACCTGGTTTAACA
(2 other experimental conditions)
Note:
Forward(SG004503) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 15351-15374Tm: 78.7C at salt 1000.0 mMLength:
Sequence: ATGGTCATGTGTGGCGGCTCACTA
(2 other experimental conditions)
Note: There is a 6-carboxyfluorescein on the 5' end and a 6-carboxtetramethylrhodamine on the 3' end.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.