A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0044Publication date: 2004
PMID: 14709637GI: 30023963 Taxonomy ID: 228404
Virus Name: SARS coronavirus HKU-39849Product size (PCR): 43 bp
MgCl2: 5.5 mMdNTPs: mMType: Real-time RT-PCR
Temp (PCR cycle):50C 120sec>95C 600sec>(95C 15sec>60C 60sec)*45
Buffer: 1X Taqman buffer A
Polymerase: 0.625U AmpliTaq Gold polymerase (Applied Biosystems)Cycler: 7000 Sequence Detection System (Applied Biosystems)
Note: Also in the reaction mix were 2microL of cDNA and 2.5U of AmpErase UNG.
Forward(SG004401) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 17718-17742Tm: 73.9C at salt 1000.0 mMLength:
Sequence: CAGAACGCTGTAGCTTCAAAAATCT
(2 other experimental conditions)
Note:
Reverse(SG004402) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 17785-17761Tm: 75.5C at salt 1000.0 mMLength:
Sequence: TCAGAACCCTGTGATGAATCAACAG
(2 other experimental conditions)
Note:
Forward(SG004403) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 17745-17760Tm: 50CLength:
Sequence: TCTGCGTAGGCAATCC
(2 other experimental conditions)
Note: The probe has a 6-carboxyfluorescein on the 5' end and a nonfluorescent quencher on the 3' end.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.