A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0043Publication date: 2003
PMID: 12927804GI: 33348772 Taxonomy ID: 201489
Virus Name: Foot-and-mouth disease virus HKN/2002Product size (PCR): 1482 bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Article gives almost no common data. The PCR product was recovered using Geneclean II Kit (Qbiogene)
Forward(F3D) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 6633-6655Tm: 75C at salt 1000.0 mMLength:
Sequence: GGGTTGATCGTTGATACCAGAGA
(0 other experimental conditions)
Note:
Reverse(R1) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 8115-8081Tm: 92.5C at salt 1000.0 mMLength:
Sequence: GGGGCGGCCGCGGATTAAGGAAGCGGGAAAAGCCC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.