A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0042Publication date: 2003
PMID: 14652014GI: 30248028 Taxonomy ID: 227984
Virus Name: SARS coronavirus Tor2Product size (PCR): 67 bp
MgCl2: mMdNTPs: mMType: Real-time PCR
Temp (PCR cycle):50C 120sec>95C 600sec>(95C 15sec>58C 60sec)*40
Buffer:
Polymerase: Hotstart Taq polyCycler: ABI Prism 7700 Sequence Detector (Applied Biosystems)
Note: Also in the reation were 50ng of cDNA, 0.4mM dUTP, and 12.5microL of 2x qPCR mastermix (Eurogentec EGT Group).
Reverse(Primer C) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18260-18239Tm: 74.7C at salt 1000.0 mMLength:
Sequence: AGTTGCATGACAGCCCTCTACA
(0 other experimental conditions)
Note:
Forward(Primer D) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18193-18211Tm: 73.7C at salt 1000.0 mMLength:
Sequence: CCCGCGAAGAAGCTATTCG
(0 other experimental conditions)
Note:
Forward(Probe E) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 18215-18237Tm: 78.6C at salt 1000.0 mMLength:
Sequence: CGTTCGTGCGTGGATTGGCTTTG
(0 other experimental conditions)
Note: This is a fluorogenic probe.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.