A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0041Publication date: 2003
PMID: 14652014GI: 30248028 Taxonomy ID: 227984
Virus Name: SARS coronavirus Tor2Product size (PCR): 100 bp
MgCl2: 5 mMdNTPs: mMType: PCR
Temp (PCR cycle):95C 180sec>(95C 10sec>60C 10sec[-1C/Cyc]>72C 20sec)*10>(95C 10sec>56C 10sec>72C 20sec)*40
Buffer: 1x PCR buffer
Polymerase: 0.04U/microL Taq DNA polymerase (Invitrogen)Cycler: MasterCycler (Eppendorf)
Note: The reaction mix also contained 100ng of cDNA template.
Forward(SARS1s) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 15271-15291Tm: 74.4C at salt 1000.0 mMLength:
Sequence: CCTCTCTTGTTCTTGCTCGCA
(3 other experimental conditions)
Note:
Reverse(SARS1as) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 15391-15371Tm: 74.4C at salt 1000.0 mMLength:
Sequence: TATAGTGAGCCGCCACACATG
(3 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.