A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0032Publication date: 03/04
PMID: 15006765GI: 33694600 Taxonomy ID: 10515
Virus Name: Human adenovirus type 2Product size (PCR): 301 bp
MgCl2: 1.5 mMdNTPs: mMType: Nested PCR
Temp (PCR cycle):94C 240sec>(92C 60sec>55C 60sec>72C 75sec)*29>72C 420sec
Buffer: 1X PCR buffer [160mM (NH4)2SO4-670mM Tris-HCl(pH 8.8)
Polymerase: 2U Taq poly (Bioron GmbH)Cycler: Gene Amp PCR 2400 (Applied Biosystems)
Note: The annealing temperature changes depending on which primer set is being used. For the second round 1microL from the first round product was added to the reaction mix with 0.16microM of the nested primers.
Forward(HL) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 18858-18883Tm: 80.5C at salt 1000.0 mMLength:
Sequence: GCCGCAGTGGTCTTACATGCACATC
(20 other experimental conditions)
Note: Outside primer. Given range is one residue too long.
Reverse(HR) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 19158-19136Tm: 82.1C at salt 1000.0 mMLength:
Sequence: CAGCACGCCGCGGATGTCCAAAGT
(1 other experimental conditions)
Note: Outside primer. Given range is one residue too short
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.