A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0018Publication date: 06/03
PMID: 14551821GI: 22770791 Taxonomy ID: 12110
Virus Name: Foot-and-mouth disease virusProduct size (PCR): 183 bp
MgCl2: 3.5 mMdNTPs: mMType: Q-RT-PCR
Temp (PCR cycle):95C 120sec>(95C 15sec>60C 15sec>75C 15sec)*55
Buffer: 400mM Tricine-KOH [pH 8.0], 160mM KCl, 37.5 microG/mL BSA
Polymerase: 1x Titanium Taq poly (Clontech Laboratories)Cycler: ABI Prism 7700 (Applied Biosystems)
Note: 2microL of template were also included in the reaction mix.
Forward(SG001801) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 107-129Tm: 71.5C at salt 1000.0 mMLength:
Sequence: GACAAAGGTTTTGTTCTTGGTCA
(0 other experimental conditions)
Note:
Reverse(SG001802) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 289-272Tm: 60CLength:
Sequence: TGCGAGTCCTGCCACGGA
(0 other experimental conditions)
Note: Fluorescent tagged primer.
Forward(SG001803) primer
Oligo type: PCR ProbeDegeneracy: 1
Target: 227-255Tm: 84.8C at salt 1000.0 mMLength:
Sequence: ATCCTCTCCTTTGCACGCCGTGGGACCAT
(0 other experimental conditions)
Note: Fluorescent tagged probe.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.