A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0010Publication date: 2004
PMID: 14656465GI: 12802528 Taxonomy ID: 10385
Virus Name: Bovine herpesvirus 4Product size (PCR): 737 bp
MgCl2: 25 mMdNTPs: mMType: Nested PCR
Temp (PCR cycle):(94C 45sec>63C 45sec>72C 90sec)*25>(94C 45sec>63C 45sec>60sec)*30>72C 600sec
Buffer: 1x appropriate buffer (Sigma-Aldrich)
Polymerase: 1U Taq DNA poly (Sigma-Aldrich)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: A total of 2-3 drops of mineral oil and 5microL of sample were added to the reaction mix. Optimal annealing temp was determined using gradient PCR in Tgradient Whatman Biometra device (Analytik GmbH). There were two rounds of PCR amplification the first cycle is the first round and the second cycle is the second round. One microL from the first PCR was taken and added to the second round.
Forward(BoG3) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 38046-38066Tm: 72.5C at salt 1000.0 mMLength:
Sequence: GACTATGAGGAATGGCACAAG
(1 other experimental conditions)
Note:
Reverse(BoGe) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 38782-38763Tm: 76.1C at salt 1000.0 mMLength:
Sequence: TACTCGTAGGCTGGGTCTGG
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.