A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SG0008Publication date: 2004
PMID: 12837557GI: 9802268 Taxonomy ID: 114429
Virus Name: Bovine adenovirus 2Product size (PCR): 2447 bp
MgCl2: 25 mMdNTPs: mMType: PCR
Temp (PCR cycle):94C 120sec>(94C 30sec>55C 60sec>72C 60sec)*40>72C 600sec
Buffer: 4.4XPCR buffer (Promega)
Polymerase: 5U/microL Taq polyCycler: MJ Research Mini-Cycler(MJ Research, Inc)
Note: Three different sizes of PCR products were amplified.
Forward(G1) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 26844-26863Tm: 74.1C at salt 1000.0 mMLength:
Sequence: CGATCCAAGCTCCTTCATGC
(1 other experimental conditions)
Note:
Reverse(R2) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 28961-28942Tm: 76.1C at salt 1000.0 mMLength:
Sequence: ACACAGCTGCGGATGTCCAC
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.