A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SC0003Publication date: 06/04
PMID: 15184466GI: 30027617 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 69 bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):61C 1200sec>95C 300sec>(95C 15sec>60C 30sec)*45
Buffer: LightCycler RNA Master Hybridization Probes kit (Roche)
Polymerase: Cycler: LightCycler RNA Master Hybridization Probes kit (Roche)
Note: LightCycler RNA Master Hybridization Probes kit (Roche)
Forward(NCCORFP) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 29052-29070Tm: 69.3C at salt 1000.0 mMLength:
Sequence: TGCCTCTGCATTCTTTGGA
(0 other experimental conditions)
Note: no common gi was found
Reverse(NCCORRP) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 29120-29102Tm: 71.5C at salt 1000.0 mMLength:
Sequence: TAAGTCAGCCATGTTCCCG
(0 other experimental conditions)
Note: no common gi was found
Forward(NCCORP) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 29075-29097Tm: 76.8C at salt 1000.0 mMLength:
Sequence: CACGCATTGGCATGGAAGTCACA
(0 other experimental conditions)
Note: 6-carboxyfluorescein at 5' end and '6-carboxy tetramethylrhodamine at 3' end
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.