A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SC0002Publication date: 05/04
PMID: 15131187GI: 48477070 Taxonomy ID: 35292
Virus Name: Foot-and-mouth disease virus SAT 2Product size (PCR): 450 bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):42C 30min>90C 5min>94C 3min>(94C 1min<55C 1 min<72C 1.5min)*40>72C 5min
Buffer: Ready-To-Go reverse transcription-PCR tube; Amersham Pharmacia Biotech
Polymerase: Cycler:
Note:
Reverse(2B208) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 4168-4149Tm: 78.2C at salt 1000.0 mMLength:
Sequence: ACAGCGGCCATGCACGACAG
(0 other experimental conditions)
Note:
Forward(1D209) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 3451-3475Tm: 75.5C at salt 1000.0 mMLength:
Sequence: CCACATACTACTTTTGTGACCTGGA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.