A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SA0009Publication date: 10/02
PMID: 12502839GI: 48429536 Taxonomy ID: 12111
Virus Name: Foot-and-mouth disease virus AProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: Multiplex RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Taq polymeraseCycler:
Note:
Forward(P1Low) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 3858-3880Tm: 80.4C at salt 1000.0 mMLength:
Sequence: CAGCAGTTGTTTCGCCGGTGCGA
(0 other experimental conditions)
Note:
Reverse(SacLow) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 3322-3303Tm: 70C at salt 1000.0 mMLength:
Sequence: AGTTTGTGTTTCTCCTCCGT
(0 other experimental conditions)
Note:
Forward(P1Up) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 1685-1707Tm: 87.5C at salt 1000.0 mMLength:
Sequence: GGAGCCGGGCAATCCAGCCCGCG
(0 other experimental conditions)
Note:
Reverse(SacUp) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 3117-3098Tm: 78.2C at salt 1000.0 mMLength:
Sequence: ACCGCGTCCAGTGAGGCTGA
(0 other experimental conditions)
Note:
Forward(4+fin) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 1912-1931Tm: 76.1C at salt 1000.0 mMLength:
Sequence: CAGCGGTCTTTTCGGTGCTC
(0 other experimental conditions)
Note:
Forward(2+Up) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 2041-2060Tm: 76.1C at salt 1000.0 mMLength:
Sequence: CGGGTACGCAACAGTTGAGG
(0 other experimental conditions)
Note:
Forward(2halfup) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 2368-2387Tm: 74.1C at salt 1000.0 mMLength:
Sequence: CCCCCACCAATTCATCAACC
(0 other experimental conditions)
Note:
Forward(VP4Low) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 1898-1917Tm: 80.2C at salt 1000.0 mMLength:
Sequence: CCGCTGAAGGCAGAGCTGGC
(0 other experimental conditions)
Note:
Reverse(VP2Low) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 2484-2465Tm: 76.1C at salt 1000.0 mMLength:
Sequence: ATGACGACAAGCGTCCAGGG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.