A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SA0005Publication date: 12/03
PMID: 15070991GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 149 bp
MgCl2: mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note:
Forward(SARSF) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 28538-28557Tm: 70C at salt 1000.0 mMLength:
Sequence: TGAATACACCCAAAGACCAC
(1 other experimental conditions)
Note:
Reverse(APNR) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 28686-28668Tm: 71.5C at salt 1000.0 mMLength:
Sequence: TGATGAGGAGCGAGAAGAG
(1 other experimental conditions)
Note: no common gi was found
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.