A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: SA0002Publication date: 12/03
PMID: 15070991GI: 30271926 Taxonomy ID: 227859
Virus Name: SARS coronavirusProduct size (PCR): 109 bp
MgCl2: mMdNTPs: mMType: Nested RT-PCR
Temp (PCR cycle):
Buffer: PCR amplification master mix
Polymerase: Superscript II/Platinum TaqCycler:
Note: Conditons were optimized, but not reported.
Forward(BNIoutS2) primer
Oligo type: PCRDegeneracy: 1
Target: 18153-18176Tm: 70.2 C at salt 1000.0mMLength:
Sequence: ATGAATTACCAAGTCAATGGTTAC
(13 other experimental conditions)
Note: Target range from sequence.
Reverse(BNIoutAs) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 18342-18321Tm: 74.7C at salt 1000.0 mMLength:
Sequence: CATAACCAGTCGGTACAGCTAC
(11 other experimental conditions)
Note:
Forward(BNlinS) primer
Oligo type: PCRDegeneracy: 1
Target: 18201-18220Tm: 72 C at salt 1000.0mMLength:
Sequence: GAAGCTATTCGTCACGTTCG
(7 other experimental conditions)
Note: Target range from sequence.
Reverse(BNIinAs) primer
Oligo type: PCRDegeneracy: 1
Target: 18309-18288Tm: 72.9 C at salt 1000.0mMLength:
Sequence: CTGTAGAAAATCCTAGCTGGAG
(7 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.