A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: RH0002Publication date: 01/99
PMID: 10203465GI: 2653291 Taxonomy ID: 31518
Virus Name: Bovine herpesvirus type 1.1 (strain Jura); Bovine herpesvirus type 1.1 (strain Cooper); Bovine herpesvirus type 1.2 (strain K22); Caprine herpesvirus 1; Rangiferine herpesvirus 1; cervid herpesvirus 1; Bovine herpesvirus 5 (strain N569)Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: Nested PCR 2
Nested PCR 1
Temp (PCR cycle):94C 9min>(95C 1min>62C 1min>72C min)*35>72C 7min
Buffer: 50mM KCl, 10mM Tris-HCl, 10% DMSO
Polymerase: 0.02U/microL Amplitaq Gold Poly (Perkin-Elmer Cetus)Cycler:
Note: Universal PCR. Primers amplify the following herpesviruses:
Bovine strain Jura [Taxonomy:31518]
Bovine strain Cooper [Taxonomy:10323]
Bovine strain K22 [Taxonomy:31519]
Caprine [Taxonomy:39944]
Rangiferine [Taxonomy:79892]
cervid [Taxonomy:79891]
Bovine strain N569 [Taxonomy:36350]

For primary PCR, [see RH0001].

Total PCR volume is 50microL containing 1microL primary PCR product and 0.3microM each primer.
Forward(CR32) primer
Oligo type: PCRDegeneracy: 2
Target: 56085-56104Tm: Max Tm 80.2 C Min Tm 78.2 C at salt 1000.0mMLength:
Sequence: TGGTGGCCTT(C/T)GACCGCGAC
(0 other experimental conditions)
Note:
Reverse(CR33) primer
Oligo type: PCRDegeneracy: 1
Target: 56378-56357Tm: 82.2 C at salt 1000.0mMLength:
Sequence: GCTCCGGCGAGTAGCTGGTGTG
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.