A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MT0003Publication date: 03/97
PMID: 9376428GI: 1173639 Taxonomy ID: 35244
Virus Name: Bovine herpesvirus 5, BHV-5Product size (PCR): 166 bp
MgCl2: 1.25 mMdNTPs: mMType: Nested PCR 2 (2)
Nested PCR 2 (1) Nested PCR 1
Temp (PCR cycle):99C 8min>(97C 60sec>75C 45sec)*4>(97C 60sec>73C 45sec)*36>72C 5min
Buffer: 1x PCR Buffer II (Perkin-Elmer), 6% glycerol
Polymerase: 0.03U/microL Taq poly (Perkin-Elmer)Cycler:
Note: For primary PCR, [see MT0001].

Total PCR volume is 50microL containing 0.2microM each primer and 1microL primary PCR product.
Polymerase is added after 99C 8min.

For other secondary PCR, [see MT0002].
Forward(5gC+) primer
Oligo type: PCRDegeneracy: 1
Target: 180-200Tm: 80.3 C at salt 1000.0mMLength:
Sequence: TTGCCCCCGCCTTCGCTTTCG
(0 other experimental conditions)
Note:
Reverse(5gC-) primer
Oligo type: PCRDegeneracy: 1
Target: 345-324Tm: 84 C at salt 1000.0mMLength:
Sequence: GCGTCCCCAAGGGCGTCTCGTC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.