A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MT0002Publication date: 03/97
PMID: 9376428GI: 330754 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV 1Product size (PCR): 274 bp
MgCl2: 1.25 mMdNTPs: mMType: Nested PCR 2 (1)
Nested PCR 1 Nested PCR 2 (2)
Temp (PCR cycle):99C 8min>90C>(97C 60sec>75C 45sec)*4>(97C 60sec>73C 45sec)*36>72C 5min
Buffer: 0.5x PCR Buffer II (Perkin-Elmer), 6% glycerol
Polymerase: 0.03/microL Taq poly (Perkin-Elmer)Cycler:
Note: For primary PCR, [see MT0001].

Total PCR volume is 50microL containing 1microL primary PCR product and 0.2microM each primer.
Polymerase is added after 99C 8min.

For other PCR in this article, [see MT0003].
Forward(1gC+) primer
Oligo type: PCRDegeneracy: 1
Target: 258-278Tm: 86.1 C at salt 1000.0mMLength:
Sequence: CTCGCCTCCGCCCTCCCCGTG
(0 other experimental conditions)
Note:
Reverse(1gC-) primer
Oligo type: PCRDegeneracy: 1
Target: 531-512Tm: 86.4 C at salt 1000.0mMLength:
Sequence: AGGCCGCCCCCCGCCGCTAG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.