A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MT0001Publication date: 03/97
PMID: 9376428GI: 330754 Taxonomy ID: 10320
Virus Name: Bovine herpesvirus 1, BHV-1;Bovine herpesvirus 5, BHV-5Product size (PCR):
bp
MgCl2: 1.0 mMdNTPs: mMType: Nested PCR 1
Temp (PCR cycle):99C 8min>(97C 1min>75C 1min)*4>(97C 1min>73C 1min)*36>72C 5min
Buffer: 0.75x Buffer II (Perkin-Elmer), 6% glycerol
Polymerase: 0.03U/microL Taq poly (Perkin-Elmer)Cycler:
Note: The primers amplify a 653bp-product of BHV-1 [Taxonomy:10320] and a 589bp-product of BHV-5 [Taxonomy:35244].

Total PCR volume is 50microL containing 0.5microM each primer and 1microL DNA.
Polymerase is added after 99C 8min.

For secondary PCRs, [see MT0002] and [see MT0003].
Forward(gC+) primer
Oligo type: PCRDegeneracy: 1
Target: 225-242Tm: 66 CLength:
Sequence: GCGGGGGCTCGCCGAGGA
(0 other experimental conditions)
Note:
Reverse(gC-) primer
Oligo type: PCRDegeneracy: 1
Target: 877-858Tm: 84.3 C at salt 1000.0mMLength:
Sequence: GGGAGCGCACGGTCAGGGGC
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.