A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0943Publication date: 08/02
PMID: 12176143GI: 12018088 Taxonomy ID: 12110
Virus Name: Foot-and-mouth disease virus, FMDVProduct size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):50C 2min>95C 10min>(95C 15sec>60C 60sec)*50
Buffer: N/A
Polymerase: N/ACycler: GeneAmp 5700 Sequence Detection System thermal cycler (Applied Biosystems)
Note: This PCR detects the following serotypes of Foot-and-mouth disease virus:
Foot-and-mouth disease virus A [Taxonomy:12111]
Foot-and-mouth disease virus Asia 1 [Taxonomy:110195]
Foot-and-mouth disease virus C [Taxonomy:12116]
Foot-and-mouth disease virus O [Taxonomy:12118]
Foot-and-mouth disease virus SAT 1 [Taxonomy:12122]
Foot-and-mouth disease virus SAT 2 [Taxonomy:35292]
Foot-and-mouth disease virus SAT 3 [Taxonomy:12123]

RT was performed in a 20microL total volume using random primers at 37C 45min. RT was performed as in Reid et al., (1999) [PMID:10598089]

PCR was performed as in Oleksiewicz et al., (2001) [PMID:11164915].
Reverse(SAmulti2-P-IR-292-269R) primer
Oligo type: Degeneracy: 1
Target: 932-909Tm: 83.8 C at salt 1000.0mMLength:
Sequence: CCTCGGGGTACCTGAAGGGCATCC
(0 other experimental conditions)
Note: This is a TaqMan probe
Forward(SA-IR-219-246F) primer
Oligo type: Degeneracy: 32
Target: 859-886Tm: Max Tm 82 C Min Tm 74.7 C at salt 1000.0mMLength:
Sequence: CAC(C/T)T(C/T)AAG(A/G)TGACA(C/T)TG(A/G)TACTGGTAC
(0 other experimental conditions)
Note:
Reverse(SA-IR-315-293R) primer
Oligo type: Degeneracy: 128
Target: N/A-N/ATm: Max Tm 78.6 C Min Tm 71.5 C at salt 1000.0mMLength:
Sequence: CAGAT(C/T)CC(A/G)AGTG(A/T)C(A/C/G/T)C(A/C/G/T)TGTTA
(0 other experimental conditions)
Note: No sequence could be found in the NCBI database to match this oligonucleotide.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.