A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0866Publication date: 12/02
PMID: 12421586GI: 7960753 Taxonomy ID: 144353
Virus Name: Bovine viral diarrhea virus, BVDVProduct size (PCR):
bp
MgCl2: 4 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 1sec>55C 15sec>72C 15sec)*45
Buffer: N/A
Polymerase: 1x LightCycler RT-PCR Enzyme MixCycler: LightCycler (Roche Diagnostics)
Note: RT-PCR performed in a total volume of 20microL using a LightCycler RNA Amplification Hybridization Probes Kit (Roche Diagnostics), 0.2microM hybridization probes BVDs1 and BVDs2 and 0.2microM primers BVDl1 and BVDu3. RT reaction occured for 55C 10min.

For additional PCR in this article, [see MP0865].
Forward(BVDs1) primer
Oligo type: Degeneracy: 1
Target: 314-336Tm: 76.8 C at salt 1000.0mMLength:
Sequence: ACGAATACAGCCTGATAGGGTGC
(0 other experimental conditions)
Note:
Forward(BVDs2) primer
Oligo type: Degeneracy: 1
Target: 339-364Tm: 77.3 C at salt 1000.0mMLength:
Sequence: CAGAGGCCCACTGTATTGCTACTAAA
(0 other experimental conditions)
Note:
Reverse(BVDl1) primer
Oligo type: Degeneracy: 1
Target: 384-364Tm: 70.5 C at salt 1000.0mMLength:
Sequence: TGCCATGTACAGCAGAGATTT
(0 other experimental conditions)
Note:
Forward(BVDu3) primer
Oligo type: Degeneracy: 1
Target: 248-267Tm: 70 C at salt 1000.0mMLength:
Sequence: CATGCCCAAAGCACATCTTA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.