A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0865Publication date: 12/02
PMID: 12421586GI: 7960753 Taxonomy ID: 11100
Virus Name: Bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR):
bp
MgCl2: 2.5 mMdNTPs: mMType: RT-Semi-nested PCR
Temp (PCR cycle):95C 3min>(95C 30sec>55C 30sec>72C 60sec)*25>72C 3min
Buffer: 1x reaction buffer (Promega), 0.02% BSA
Polymerase: 0.02U/microL Taq DNA poly (Promega)Cycler: PTC 200 thermal cycler (MJ Research)
Note: RT reaction performed in a total volume of 20microL including 1.25microM primer BVD43, 0.5microM dNTPs, 1x M-MLV RT buffer (Promega), 5U/microL MMLV RTase (Promega), and 0.5U/microL to 1U/microL recombinant RNasin (Promega).
RT reaction: 41C 1hr.

PCR was performed in a total volume of 50microL and containing the RT reaction, 0.5microM primers BVD43 and BVDu1. A secondary semi-nested reaction was performed using 2microL of the first reaction under the same conditions except with 40 cycles instead of 25 and using primers BVD43 and BCDu2.
For additional PCR in article, [see MP0866].
Reverse(BVD43) primer
Oligo type: Degeneracy: 1
Target: 395-375Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:
Forward(BVDu1) primer
Oligo type: Degeneracy: 6
Target: 176-197Tm: Max Tm 78.5 C Min Tm 74.7 C at salt 1000.0mMLength:
Sequence: CCTGAGTACAGG(A/G)(C/G/T)AGTCGTCA
(0 other experimental conditions)
Note:
Forward(BVDu2) primer
Oligo type: Degeneracy: 8
Target: 227-244Tm: Max Tm 58 C Min Tm 52 CLength:
Sequence: GA(G/T)ATGC(C/T)A(C/T)GTGGACGA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.