A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0843Publication date: 09/02
PMID: 12237113GI: 5921457 Taxonomy ID: 12110
Virus Name: Foot-and-mouth disease virus, FMDVProduct size (PCR): N/A bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 2min>(94C 60sec>55C 40sec>72C 60sec)*40>72C 10min
Buffer: 1x PCR buffer (Gibco-BRL)
Polymerase: 0.04U/microL Taq DNA poly (Gibco-BRL)Cycler: Robocycler (Stratagene)
Note: Primers amplifies the following FMDV strains:
Foot-and-mouth disease virus A [Taxonomy:12111]
Foot-and-mouth disease virus C [Taxonomy:12116]
Foot-and-mouth disease virus O [Taxonomy:12118]
Foot-and-mouth disease virus SAT 1 [Taxonomy:12122]
Foot-and-mouth disease virus SAT 2 [Taxonomy:35292]
Foot-and-mouth disease virus SAT 3 [Taxonomy:12123]
Foot-and-mouth disease virus Asia 1 [Taxonomy:110195]

RT Procedure: 5microM random hexamer (Gibco-BRL) and 1microgRNA were incubated 70C 10min. Then 1U/microL RNasin inhibitor (Promega), 1x first strand buffer (Gibco-BRL), 10mM DTT, 1mM dNTPs were added and kept at room temperature 10min>42C 2min. Finally, 10U/microL SuperScript II RNase H-Reverse Transcriptase (Gibco-BRL) added and reaction incubated 42C 50min>70C 15min.

No final volumes for either the RT or PCR procedure were found in the article.
Reverse(SP-FOR) primer
Oligo type: PCRDegeneracy: 1
Target: 551-570Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CTTCTCAGATCCCGAGTGTC
(0 other experimental conditions)
Note:
Forward(SP-REV) primer
Oligo type: PCRDegeneracy: 1
Target: 341-359Tm: 71.5 C at salt 1000.0mMLength:
Sequence: TGTTTCGTAGCGGAGCATG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.