A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0735Publication date: 07/02
PMID: 12088821GI: 18074008 Taxonomy ID: 110195
Virus Name: Foot-and-mouth disease virus Asia 1, FMDVProduct size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(93C 30sec>55C 120sec>72C 300sec)*40>72C 10min
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: One step RT-PCR performed using a RNeasy kit (QIAGEN) according to the manufacturers instructions.

For additional PCRs in this article, [see MP0734], [see MP0736], and [see MP0737].
Forward(VP4) primer
Oligo type: Degeneracy: 2
Target: 1769-1791Tm: Max Tm 76.8 C Min Tm 75 C at salt 1000.0mMLength:
Sequence: CAGTACCAGAA(C/T)TCCATGGACAC
(0 other experimental conditions)
Note: Mismatches at positions 1774 and 1777.
Reverse(P4) primer
Oligo type: Degeneracy: 1
Target: 3946-3926Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.