A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0441Publication date: 08/95
PMID: 7559950GI: 510229 Taxonomy ID: 10255
Virus Name: Variola virus, VARProduct size (PCR): N/A bp
MgCl2: 1.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):(94C 1min>55C 2min>72C 3min)*25
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3)
Polymerase: 0.025U/microL DNA poly (Perkin-Elmer Cetus Corp., Norwalk, Conn.)Cycler: Model 9600 thermal cycler (Perkin-Elmer Cetus)
Note: PCR uses 0.5mM of each oligonucleotide in 100microL total volume.
For the other virus specific PCRs in this artice see: [see MP0439],[see MP0440], [see MP0442], [see MP0443], [see MP0444], [see MP0445], [see MP0446], [see MP0447], [see MP0448], [see MP0449], [see MP0450].
Forward(VAR1) primer
Oligo type: PCRDegeneracy: 1
Target: 276-293Tm: 46 CLength:
Sequence: TAAATCATTGACTGCTAA
(0 other experimental conditions)
Note:
Reverse(VAR2) primer
Oligo type: PCRDegeneracy: 1
Target: 761-739Tm: 69.7 C at salt 1000.0mMLength:
Sequence: GTAGATGGTTCATTATCATTGTG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.