A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0424Publication date: 1986
PMID: 3034729GI: 10445391 Taxonomy ID: 12121
Virus Name: foot-and-mouth disease virus C1, FMDVProduct size (PCR): N/A bp
MgCl2: 10 mMdNTPs: mMType: cDNA synthesis
Temp (PCR cycle):42C 1hr
Buffer: 2mM methylmercury hydroxide, 50mM Tris-HCl pH 8.3, 50mM KCl, 0.4mM DTT
Polymerase: N/ACycler: N/A
Note: cDNA synthesis: Reaction occus in a total volume of 100microL. Reaction mixture includes primer PD00520, 0.125mM [alpha-32P]dCTP (880cpm/pmol), 1U/microL human placental RNase inhibitor (Amersham), and 8.7U/microg RNA reverse transcriptase (Boehringer).
Concentration of primer was not found in the article.
Reverse(PD00520) primer
Oligo type: Degeneracy: 1
Target: 3888-3869Tm: 78.2 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGATC
(0 other experimental conditions)
Note: Mismatch at positions 3869 and 3870
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.