A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0394Publication date: 08/97
PMID: 9274816GI: 576561 Taxonomy ID: 12123
Virus Name: Foot-and-mouth disease virus SAT 3Product size (PCR): 301 bp
MgCl2: 1.5 mMdNTPs: mMType: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Primer P1, [GI:61076], is used with following primers in a multiplex PCR format:
P130/P158/P159/P160/P161 all derived from [GI:576561].
For more primers used in this PCR, [see MP0392] and [see MP0393].

Total RT volume is 10microL containing 6microL RNA, 0.6U/microL RNase inhibitor (TakaRa biochemicals), 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 10mM dithiothreitol, 0.125mM each dNTP, 5microM primer P33 (described by Vangrysperre et al, (1996) [PMID:8634024]), and 10U/microL MMLV RTase (Life Technologies).
RT temperature: 42C 5min.

Total PCR volume is 10microL containing 0.2% cDNA, 0.6microM P1, 0.3microM P130, 0.6microM P158, 0.3microM P159, 0.3microM P160, and 0.9microM P161.
Reverse(P1) primer
Oligo type: Degeneracy: 1
Target: 3578-3558Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST
Forward(P130) primer
Oligo type: Degeneracy: 1
Target: 2080-2098Tm: 67.2 C at salt 1000.0mMLength:
Sequence: TTCGGAAGATTGTTGTGTG
(4 other experimental conditions)
Note: Target found in article (3467-3487) is different from target found in article.
Specific to [GI:576561].
Forward(P158) primer
Oligo type: Degeneracy: 4
Target: 2080-2098Tm: Max Tm 71.5 C Min Tm 67.2 C at salt 1000.0mMLength:
Sequence: TTCGG(T/G)AGA(C/T)TGTTGTGTG
(4 other experimental conditions)
Note: Specific to [GI:576561].
Forward(P159) primer
Oligo type: Degeneracy: 1
Target: 2080-2098Tm: 71.5 C at salt 1000.0mMLength:
Sequence: TTCGGTAGGCTGTTGTGTG
(4 other experimental conditions)
Note: Mismatches at positions 2085, 2088, and 2089.
Target found in article (3469-3487) was different from target determined in BLAST.
Specific to [GI:576561].
Forward(P160) primer
Oligo type: Degeneracy: 1
Target: 2080-2098Tm: 73.7 C at salt 1000.0mMLength:
Sequence: TTCGGGAGACTGTTGTGCG
(4 other experimental conditions)
Note: Mismatches at positions 2085, 2089, and 2097.
Target found in article (3469-3487) is different from target determined in BLAST.
Specific to [GI:576561].
Forward(P161) primer
Oligo type: Degeneracy: 8
Target: 2080-2099Tm: Max Tm 74.1 C Min Tm 67.9 C at salt 1000.0mMLength:
Sequence: TTCGG(T/G)AG(A/G)(C/T)TGTTGTGTGA
(4 other experimental conditions)
Note: Specific to [GI:576561].
Reverse(P33) primer
Oligo type: Degeneracy: 1
Target: 3851-3832Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.