A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0393Publication date: 08/97
PMID: 9274816GI: 6572136 Taxonomy ID: 35292
Virus Name: Foot-and-mouth disease virus SAT 2Product size (PCR): 75 bp
MgCl2: 1.5 mMdNTPs: mMType: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Primer P1, [GI:61076], is used with following primers in a multiplex PCR format:
P168/P169/P170 all derived from [GI:6572136].
For more primers used in this PCR, [see MP0392] and [see MP0394].

Total RT volume is 10microL containing 6microL RNA, 0.6U/microL RNase inhibitor (TakaRa biochemicals), 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 10mM dithiothreitol, 0.125mM each dNTP, 5microM primer P33 (described by Vangrysperre et al, (1996) [PMID:8634024]), and 10U/microL MMLV RTase (Life Technologies).
RT temperature: 42C 5min.

Total PCR volume is 10microL containing 0.2% cDNA, 0.6microM P1, 0.6microM P168, 0.3microM P169, and 6microM P170.
Reverse(P1) primer
Oligo type: Degeneracy: 1
Target: 3578-3558Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST
Forward(P168) primer
Oligo type: Degeneracy: 2
Target: 3477-3496Tm: 73.6 C at salt 1000.0mMLength:
Sequence: GGCGTTGAAAAACAACT(G/C)TG
(4 other experimental conditions)
Note: Specific to [GI:6572136].
Forward(P169) primer
Oligo type: Degeneracy: 1
Target: 3477-3496Tm: 74.1 C at salt 1000.0mMLength:
Sequence: GGCGTCGCGAAACAGCTTTT
(7 other experimental conditions)
Note: Specific to [GI:6572136].
Forward(P170) primer
Oligo type: Degeneracy: 32
Target: 3477-3496Tm: Max Tm 76.1 C Min Tm 65.8 C at salt 1000.0mMLength:
Sequence: GG(C/T)GT(C/T)GA(A/G)AAACA(A/G)(C/T)TGTG
(1 other experimental conditions)
Note: Specific to [GI:6572136].
Reverse(P33) primer
Oligo type: Degeneracy: 1
Target: 3851-3832Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.