A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0391Publication date: 08/97
PMID: 9274816GI: 61076 Taxonomy ID: 12111
Virus Name: Foot-and-mouth disease virus, FMDVProduct size (PCR): 131 bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 10sec>(95C 0sec>60C 0sec)*30>60C 10sec
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note: Universal PCR. Primers amplify the following viruses:
Foot-and-mouth disease virus A [Taxonomy:12111]
Foot-and-mouth disease virus C [Taxonomy:12116]
Foot-and-mouth disease virus O [Taxonomy:12118]
Foot-and-mouth disease virus Asia 1 [Taxonomy:110195]
Foot-and-mouth disease virus SAT 1 [Taxonomy:12122]
Foot-and-mouth disease virus SAT 2 [Taxonomy:35292]
Foot-and-mouth disease virus SAT 3 [Taxonomy:12123]

Total RT volume is 10microL containing 6microL RNA, 0.6U/microL RNase inhibitor (TakaRa biochemicals), 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 10mM dithiothreitol, 0.125mM each dNTP, 5microM primer P33, and 10U/microL MMLV RTase (Life Technologies).
RT temperature: 42C 5min.

Total PCR volume is 10microL containing 0.6microM each primer and 2% cDNA. For PCR cycle, 0sec represents the time needed to ramp up/down to the temperature.

Primers P33/P32 are described Vangrysperre et. al. 1996 [PMID:8634024].

For other PCRs in this article, [see MP0392], [see MP0393], and [see MP0394].
Reverse(P33) primer
Oligo type: Degeneracy: 1
Target: 3851-3832Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:
Forward(P32) primer
Oligo type: Degeneracy: 1
Target: 3721-3740Tm: 74.1 C at salt 1000.0mMLength:
Sequence: CAGATGCAGGAGGACATGTC
(3 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.