A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0316Publication date: 12/99
PMID: 10598089GI: 61076 Taxonomy ID: 12118
Virus Name: Foot-and-mouth disease virus O, FMDV O; Foot-and-mouth disease virus A, FMDV A; Foot-and-mouth disease virus C, FMDV C; Foot-and-mouth disease virus Asia 1, FMDV Asia 1Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>58C 1min>72C 2min)*20>72C 7min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Multiplex PCR.
Primer set P33/P38 amplifies FMDV O [Taxonomy:12118].
Primer set P33/P87/P88/P89/P90/P91/P92 amplifies FMDV A [Taxonomy:12111].
Primer set P33/P40 amplifies FMDV C [Taxonomy:12116].
Primer set P33/P74/P75/P76/P77 amplifies FMDV Asia 1 [Taxonomy:110195].

5microL RNA is heated at 70C 5min with 10pmol random hexanuclotide mix (Promega) and then cooled at room temperature for 10min.
Total RT volume is 20microL containing RNA-primer mix, 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 100ng/microL BSA, 0.5mM each dNTP (Bio-gene), 10mM dithiothreitol, and 10U/microL MMLV RTase (Gibco Life Technologies).
RT temperature: 37C 45min

Total PCR volume is 50microL containing 5microL cDNA and 0.2microM each primers P33, P38, P87, P88, P89, P90, P91, P92, P40, P74, P75, P76, and P77 in a multiplex PCR format.
The annealing temperature works just as well at 59C as it does at 58C.
For continued list of primers, [see MP0307].

For other PCRs in this article, [see MP0308], [see MP0309], [see MP0310], and [see MP0311].
Forward(P40) primer
Oligo type: Degeneracy: 1
Target: 3259-3279Tm: 70.5 C at salt 1000.0mMLength:
Sequence: GTTTCTGCACTTGACAACACA
(1 other experimental conditions)
Note: Target given in article.
Specific to 1D region.
Forward(P74) primer
Oligo type: Degeneracy: 1
Target: 3559-3578Tm: 80.2 C at salt 1000.0mMLength:
Sequence: GACACCACTCAGGACCGCCG
(1 other experimental conditions)
Note: Target given in article.
Specific to 1D region.
Forward(P75) primer
Oligo type: Degeneracy: 1
Target: 3559-3578Tm: 82.3 C at salt 1000.0mMLength:
Sequence: GACACCACCCAGGACCGCCG
(1 other experimental conditions)
Note: Target given in article.
Specific to 1D region.
Forward(P76) primer
Oligo type: Degeneracy: 1
Target: 3559-3578Tm: 78.2 C at salt 1000.0mMLength:
Sequence: GACACCACACAAGACCGCCG
(1 other experimental conditions)
Note: Target given in article.
Specific to 1D region.
Forward(P77) primer
Oligo type: Degeneracy: 1
Target: 3559-3578Tm: 78.2 C at salt 1000.0mMLength:
Sequence: GACACGACTCAGAACCGCCG
(1 other experimental conditions)
Note: Target given in article.
Specific to 1D region.
Reverse(P33) primer
Oligo type: Degeneracy: 1
Target: 3851-3832Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.