A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0315Publication date: 12/99
PMID: 10598089GI: 576561 Taxonomy ID: 12122
Virus Name: Foot-and-mouth disease virus SAT 1; Foot-and-mouth disease virus SAT 2; Foot-and-mouth disease virus SAT 3Product size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 5min>(95C 15sec>60C 60sec)*25>60C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl
Polymerase: 0.1U/microL Taq DNA poly (Gibco Life Technologies)Cycler: Touchdown Thermocycler (Hybaid, UK)
Note: Mulitplex PCR.
Primer set P1/P126/P151/P152/P153 amplifies SAT1 [Taxonomy:12122].
Primer set P1/P168/P169/P170 amplifies SAT2 [Taxonomy:35292].
Primer set P1/P130/P158/P159/P160/P161 amplifies SAT3 [Taxonomy:12123].

Total RT volume is 10microL containing 0.5microL RNA, 1microM random hexanuclotide mix (Promega), 50mM Tris-HCl (pH 8.3), 75mM KCl, 3mM MgCl2, 0.125mM each dNTP, 10mM dithiothreitol, and 10U/microL MMLV RTase (Gibco Life Technologies).
RT temperature: 37C 15min

Total PCR volume is 50microL containing 5microL cDNA and 0.2microM each primers P1, P126, P151, P152, P153, P168, P169, P170, P130, P158, P159, P160, and P161 in a multiplex PCR format.
For continued list of primers, [see MP0314].

For other PCRs in this article, [see MP0307], [see MP0308], [see MP0310], and [see MP0312].
Reverse(P1) primer
Oligo type: Degeneracy: 1
Target: 3551-3531Tm: 80.3 C at salt 1000.0mMLength:
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in article (3649-3670) is different from target found in BLAST.
Universal primer specific to [GI:6572136].
Forward(P130) primer
Oligo type: Degeneracy: 1
Target: 2080-2098Tm: 67.2 C at salt 1000.0mMLength:
Sequence: TTCGGAAGATTGTTGTGTG
(4 other experimental conditions)
Note: Target found in article (3467-3487) is different from target found in article.
Specific to [GI:576561].
Forward(P158) primer
Oligo type: Degeneracy: 4
Target: 2080-2098Tm: Max Tm 71.5 C Min Tm 67.2 C at salt 1000.0mMLength:
Sequence: TTCGG(T/G)AGA(C/T)TGTTGTGTG
(4 other experimental conditions)
Note: Specific to [GI:576561].
Forward(P159) primer
Oligo type: Degeneracy: 1
Target: 2080-2098Tm: 71.5 C at salt 1000.0mMLength:
Sequence: TTCGGTAGGCTGTTGTGTG
(4 other experimental conditions)
Note: Mismatches at positions 2085, 2088, and 2089.
Target found in article (3469-3487) was different from target determined in BLAST.
Specific to [GI:576561].
Forward(P160) primer
Oligo type: Degeneracy: 1
Target: 2080-2098Tm: 73.7 C at salt 1000.0mMLength:
Sequence: TTCGGGAGACTGTTGTGCG
(4 other experimental conditions)
Note: Mismatches at positions 2085, 2089, and 2097.
Target found in article (3469-3487) is different from target determined in BLAST.
Specific to [GI:576561].
Forward(P161) primer
Oligo type: Degeneracy: 8
Target: 2080-2099Tm: Max Tm 74.1 C Min Tm 67.9 C at salt 1000.0mMLength:
Sequence: TTCGG(T/G)AG(A/G)(C/T)TGTTGTGTGA
(4 other experimental conditions)
Note: Specific to [GI:576561].
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.