A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0306Publication date: 08/95
PMID: 8530568GI: 61076 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1Campos), FMDVProduct size (PCR): N/A bp
MgCl2: 0.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 45sec>54C 45sec>72C 90sec)*30>72C 7min
Buffer: PCR buffer(33.33mM KCl, 33.33mM Tris HCl, pH 8.3)
Polymerase: 0.0833U/microL Taq polyCycler: Thermocycler (Perkin Elmer Cestus)
Note: In the PCR instead of DNTP this experiment used 0.66microM digoxigenin-11-dUTP (Boehringer)
RT procedure - 0.166/microL RT buffer (BRL), 0.066M DTT, 0.66mM dNTP mixture (Pharmacia), 1.33U/microL RNasin (BRL), 0.166U/microL MoLV reverse transcriptase (BRL), 0.66microM downstream primer.
RT reaction carried out at 42C 30min>95C 10min
Forward(PL000900) primer
Oligo type: Degeneracy: 1
Target: 6361-6380Tm: 76.1 C at salt 1000.0mMLength:
Sequence: TTGCACCCACCGTTGCACAC
(0 other experimental conditions)
Note:
Reverse(PL000901) primer
Oligo type: Degeneracy: 1
Target: 6635-6616Tm: 76.1 C at salt 1000.0mMLength:
Sequence: TTCCATGGCGTCGAGTCCGT
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.