A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0305Publication date: 08/01
PMID: 11390103GI: 15216732 Taxonomy ID: 73482
Virus Name: Foot-and-mouth disease virus (strain O1), FMDVProduct size (PCR):
bp
MgCl2: 1.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):42C 40min>(95C 15sec>60C 60sec)*35
Buffer: 1x DyNAZyme buffer (Finnzymes OY), 0.16U/microLRNAsin (Promega), 0.032U/microL AMV RTase (Promega)
Polymerase: 0.01U/microL DyNAZyme DNA poly (Finnzymes OY)Cycler: Gene Amp CR System 9600 (Perkin Elmer)
Note: This is a one-tube RT-PCR.
Total RT-PCR volume is 50microL containing 20microM each primer and 6microL RNA sample.
Article gives final dNTPs as 1.25microM = 0.00125mM.
Forward(P38) primer
Oligo type: Degeneracy: 1
Target: 3358-3375Tm: 56 CLength:
Sequence: GCTGCCTACCTCCTTCAA
(2 other experimental conditions)
Note:
Reverse(P33) primer
Oligo type: Degeneracy: 1
Target: 3759-3740Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.