A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0299Publication date: 06/99
PMID: 10325368GI: 7960753 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR): N/A bp
MgCl2: 2 mMdNTPs: mMType: RT-Nested Multiplex PCR 1
Temp (PCR cycle):(94C 20sec>50C 30sec>72C 30sec)*25>72C 15min
Buffer: 20mM Tris-HCl [pH 8.4], 50mM KCl
Polymerase: 0.025U/microL Taq DNA poly (Canadian Life Technologies)Cycler: N/A
Note: This article involved two major steps a single step RT-PCR and a Nested Multiplex within that.
RT reaction: 0.1U/microL RNAguard RNase inhibitor (Pharmacia) and 1U/microL Moloney murine leukemia virus reverse transcriptase (Canadian Life Technologies) were included in the tube. RT reaction was carried out at 37C 30min>94C 3min.
For the Nested Multiplex PCR reaction [see MP0300]
Reverse(PD00079) primer
Oligo type: Degeneracy: 1
Target: 11547-11528Tm: 72 C at salt 1000.0mMLength:
Sequence: AAGAAGCCATCATCCCCACA
(0 other experimental conditions)
Note:
Forward(PD00080) primer
Oligo type: Degeneracy: 2
Target: 10385-10404Tm: Max Tm 72 C Min Tm 70 C at salt 1000.0mMLength:
Sequence: AAGATCCACCCTTATGA(A/G)GC
(1 other experimental conditions)
Note: Mismatches at positions 10390, 10397, and 10400.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.