A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0264Publication date: 04/97
PMID: 9129644GI: 7960753 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR): 288 bp
MgCl2: 2.5 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 1min>56C 1min>72C 1min)*35>72C 7min
Buffer: 1x PCR buffer (10mM Tris-HCl, pH 9.0, 50mM KCl, 0.1mg/ml BSA)
Polymerase: 0.02U/microL Taq poly (Perkin Elmer-Cetus)Cycler: Perkin Elmer Cetus Thermocycler
Note: RT procedure- Mixture for cDNA synthesis consisted of 4microL extracted RNA, 0.0008U/microL random Hexamers (Pharmacia). Solution incubated at 65C 5min. Then 0.96U/microL RNAguard (Pharmacia), 5microL 1st strand reaction buffer(Gibco BRL), 0.2mM dNTP (Pharmacia), 8U/microL Moloney murine leukaemia virus reverse transcriptase (Gibco). Reaction then incubated at 37C 90min>98C 5min.
This article contained two PCRs,
NC region: [see MP0264]
p20 region: [see MP0265]
Forward(primer 324) primer
Oligo type: Degeneracy: 2
Target: 108-128Tm: 73.9 C at salt 1000.0mMLength:
Sequence: ATGCCC(A/T)TAGTAGGACTAGCA
(6 other experimental conditions)
Note:
Reverse(primer 326) primer
Oligo type: Degeneracy: 1
Target: 395-375Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.