A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0153Publication date: 02/98
PMID: 9787488GI: 9626649 Taxonomy ID: 144353
Virus Name: Bovine viral diarrhea virus, BVDVProduct size (PCR): 169 bp
MgCl2: 2.5 mMdNTPs: mMType: RT-Nested PCR 2
RT-Nested PCR 1 RT-Nested PCR 2 RT-Nested PCR 1
Temp (PCR cycle):(94C 45sec>55C 30sec>72C 60sec)*5>(94C 45sec>50C 60sec>72C 180sec)*30>72C 7min
Buffer: 10mM Tris-HCl, pH 9.0, 50mM KCl and 100microg/mL BSA
Polymerase: 0.02U/microL Taq poly (Perkin-Elmer Cetus)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: For the RT and primary nested PCR [see MP00153]
PCR was performed in 50microL total volume with 1mL of first PCR product and 0.3microM each primer.
The article says 1ml of first PCR product but it is most likely 1microL.
Forward(OPES 11) primer
Oligo type: Degeneracy: 1
Target: 178-205Tm: 82 C at salt 1000.0mMLength:
Sequence: TGAGTACAGGGTAGTCGTCAGTGGTTCG
(0 other experimental conditions)
Note:
Reverse(OPES 12a) primer
Oligo type: Degeneracy: 1
Target: 346-325Tm: 78.5 C at salt 1000.0mMLength:
Sequence: GGCCTTTGCAGCACCCTATCAG
(0 other experimental conditions)
Note: Mismatch at BLAST position 341.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.