A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0152Publication date: 02/98
PMID: 9787488GI: 9626649 Taxonomy ID: 144353
Virus Name: Bovine viral diarrhea virus, BVDVProduct size (PCR): 296 bp
MgCl2: 2.5 mMdNTPs: mMType: RT-Nested PCR 1
RT-Nested PCR 2
Temp (PCR cycle):(94C 45sec>50C 30sec>72C 60sec)*5>(94C 45sec>45C 60sec>72C 180sec)*30>72C 7min
Buffer: 10mM Tris-HCl, pH 9.0, 50mMKCl and 0.1mg/mL BSA
Polymerase: 0.02U/microL Taq poly (Perkin-Elmer Cetus, Norwalk, Ct, USA)Cycler: DNA Thermal Cycler (Perkin-Elmer Cetus)
Note: RT procedure: 8microL total with 5microL RNA mixed with 0.011U/microL random Hexamer is denatured at 56C 5min>cooled on ice 5min.
This 8microL is added to 9.5microL to total 17.5microL containing 1.4xfirst strand buffer (Gibco BRL), 0.286mM each dNTPs (Pharmacia), 1microL of RNase Inhibitor (RNAguard, Pharmacia) and 21U/mircroL of Murine Leukemia virus RTase (Gibco,BRL).
RT temperature: 37C 90min>98C 5min.
PCR occured in a total volume of 100microL with 0.3microM of each primer and 5microL of cDNA.
For second Nested PCR [see MP00153]
Forward(OPES 13a) primer
Oligo type: Degeneracy: 1
Target: 101-122Tm: 76.6 C at salt 1000.0mMLength:
Sequence: GCTAGCCATGCCCTTAGTAGGA
(0 other experimental conditions)
Note:
Reverse(OPES 114a) primer
Oligo type: Degeneracy: 1
Target: 396-372Tm: 75.5 C at salt 1000.0mMLength:
Sequence: ATCAACTCCATGTGCCATTTACAGC
(0 other experimental conditions)
Note: Mismatch at BLAST position 378.
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.