A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0143Publication date: 1999
PMID: 10403696GI: 902376 Taxonomy ID: 144353
Virus Name: bovine viral diarrhea virus, BVDVProduct size (PCR): 347 bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(94C 1min>56C 1min>72C 1min)*35
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: RT: Synthesis of cDNA was carried out using random hexamers and Moloney murine leukaemia virus reverse transcriptase.
RT-PCR performed as in:(PMID: 8031236) Vilcek S., Herring A.J., Herring J.A., Nettleton P.F., Lowings J.P., and Paton D.J., Arch Virol 136, 309-323, 1994.
Forward(B21) primer
Oligo type: PCRDegeneracy: 1
Target: 12137-12158Tm: 76.6 C at salt 1000.0mMLength:
Sequence: AGCACTGGTGTCACTCTGTTGG
(0 other experimental conditions)
Note: Target area found in article
Reverse(B22) primer
Oligo type: PCRDegeneracy: 1
Target: 12483-12462Tm: 74.7 C at salt 1000.0mMLength:
Sequence: ACCATGGACGTCGAGTTAACCT
(0 other experimental conditions)
Note: Target area found in article
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.