A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0111Publication date: 10/94
PMID: 7597858GI: 9626649 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDVProduct size (PCR): 1073 bp
MgCl2: 1.5 mMdNTPs: mMType: RT-Nested PCR 1
Temp (PCR cycle):94C 45sec>(94C 45sec>55C 45sec[+2sec/cyc]>72C 30sec[+5sec/cyc])*25>72C 10min
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% gelatin, 0.1% Triton X-100
Polymerase: 0.01U/microL Tth polyCycler:
Note: RT and primary PCR is performed as described by Gruber et al, (1993) [PMID:8408445].

Total PCR volume is 50microL containing cDNA and 1microM each primer.
Polymerase is added at 70C after the first denaturation step.

Other strains of BVDV produce a 803bp product.

For secondary PCR, [see MP0112].
For other PCR in this article, [see MP0110].
Forward(MP01111) primer
Oligo type: PCRDegeneracy: 1
Target: 4661-4683Tm: 69.7 C at salt 1000.0mMLength:
Sequence: GAAAGCAAAGGCTTAAAGAAGTT
(1 other experimental conditions)
Note:
Reverse(MP01112) primer
Oligo type: PCRDegeneracy: 1
Target: 5732-5711Tm: 74.7 C at salt 1000.0mMLength:
Sequence: TGACGCCATACTCTGTCTCATC
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.