A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0087Publication date: 10/93
PMID: 8264668GI: 9626649 Taxonomy ID: 11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV NADLProduct size (PCR): N/A bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 4min 30sec>(95C 30sec>50C 30sec>72C 30sec)*36
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: RT and PCR procedures - (PMID: 1318605)Qi, F.-X., Ridpath, J.F., Lewis, T., Bolin, S.R. & Berry, E.S. (1992). Analysis of the bovine viral diarrhea virus genome for possible cellular insertions. Virology, 189, 285-92. ; According to BLAST search, both primers are forward primers
Forward(10) primer
Oligo type: PCRDegeneracy: 1
Target: 97-116Tm: 74.1 C at salt 1000.0mMLength:
Sequence: AGAGGCTAGCCATGCCCTTA
(0 other experimental conditions)
Note:
Forward(20) primer
Oligo type: PCRDegeneracy: 1
Target: 314-331Tm: 52 CLength:
Sequence: ACGAATACAGCCTGATAG
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.