A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0086Publication date: 06/94
PMID: 8074863GI: 9864638 Taxonomy ID: 144353
Virus Name: bovine viral diarrhea virus, BVDVProduct size (PCR): 288 bp
MgCl2: 0.85 mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):(95C 1min>60C 1min)*40
Buffer: 1x Tth reaction buffer (10mM Tris-HCl, pH 8.3, 90mM KCl)
Polymerase: 0.2U/microL rTth DNA poly (Perkin-Elmer, Norwalk, CT, USA)Cycler: N/A
Note: This is a single-tube method for RT-PCR. RT reaction was carried out at 70C for 15min.
Forward(P1) primer
Oligo type: PCRDegeneracy: 1
Target: 106-126Tm: 72.5 C at salt 1000.0mMLength:
Sequence: ATGCCCTTAGTAGGACTAGCA
(0 other experimental conditions)
Note:
Reverse(P2) primer
Oligo type: PCRDegeneracy: 1
Target: 392-372Tm: 72.5 C at salt 1000.0mMLength:
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.