A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: MP0084Publication date: 02/98
PMID: 9633045GI: N/A Taxonomy ID: 136447
Virus Name: bovine viral diarrhea virus type 2, BVDV-2Product size (PCR): N/A bp
MgCl2: N/A mMdNTPs: mMType: Nested RT-PCR
Temp (PCR cycle):(94C 10sec>50C 15sec>72C 30sec)*30>72C 10min
Buffer: 1x PCR buffer (Boehringer Mannheim Corp., Indianapolis, IN, USA)
Polymerase: 0.025U/microL Taq poly (Boehringer Mannheim Corp., Indianapolis, IN, USA)Cycler: N/A
Note: RT procedure - materials 0.5U/microL MMLV reverse transcriptase (Gibco/BRL, Gaithersburg, MD, USA), 0.25U/microL RNAsin (Promega, Madison, WI, USA), 1x PCR buffer (Boehringer Mannheim Corp., Indianapolis, IN, USA), 0.025U/microL Taq poly (Boehringer Mannheim Corp., Indianapolis, IN, USA). RT reaction 56C 1hr>94C 4min.
Primer information:(PMID: 7676648) Ridpath, J. F. & Bolin, S. R. (1995). The genomic sequence of a virulent bovine viral diarrhea virus (BVDV) from the type 2 genotype: detection of a large genomic insertion in a noncytopathic BVDV. Virology 212, 39-46
Forward(MP00841) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 52 CLength:
Sequence: CATGCCCATAGTAGGAC
(0 other experimental conditions)
Note: First PCR amplifies BVDV1 and BVDV2
Reverse(MP00842) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 52 CLength:
Sequence: CCATGTGCCATGTACAG
(4 other experimental conditions)
Note: First PCR amplifies BVDV1 and BVDV2
Forward(MP00843) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 72 C at salt 1000.0mMLength:
Sequence: CGACACTCCATTAGTTGAGG
(4 other experimental conditions)
Note: Second (nested) PCR only amplifies BVDV2
Reverse(MP00844) primer
Oligo type: PCRDegeneracy: 1
Target: N/A-N/ATm: 72 C at salt 1000.0mMLength:
Sequence: GTCCATAACGCCACGAATAG
(4 other experimental conditions)
Note: Second (nested) PCR only amplifies BVDV2
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.